Artigo

Melhoria da detecção do Mycobacterium tuberculosis no escarro usando DNA extraído por sonicação

São Paulo, 27 de novembro de 2020
 

A tuberculose (TB) é uma das principais causas de morte e a principal causa de um único agente infeccioso no mundo. Um milhão de pessoas continuam adoecendo com tuberculose a cada ano. Estima-se que mais de 1,7 bilhão de pessoas (cerca de 25% da população mundial) estejam infectadas com M. tuberculosis. Em 2017, 10 milhões de pessoas adoeceram com tuberculose e 1,6 milhão morreram.

 

O diagnóstico precoce é uma das estratégias de combate à doença. Metodologias baseadas na amplificação de ácidos nucléicos por Reação em Cadeia da Polimerase (PCR) para detecção de DNA de M. tuberculosis aprimoraram o diagnóstico e podem superar problemas associados aos métodos clássicos. A utilização de técnicas moleculares, além de contribuir para detectar o aumento do número de casos de TB, também permite caracterizar rapidamente a resistência e definir os genótipos existentes em uma determinada comunidade.

 

No entanto, as diferenças de sensibilidade e especificidade ao usar técnicas de PCR são uma realidade. Existem muitas razões para essa variabilidade. Um é o protocolo de extração de DNA aplicado. O método de extração de DNA deve proporcionar bom rendimento e DNA de qualidade, eliminação de inibidores de PCR, implementável como técnica de laboratório, resultando em um material genético de boa qualidade para análises moleculares adicionais, embora seja simples e rápido. 

 

Muitos métodos comerciais estão disponíveis (QIAGEN QIAmp DNA mini kit, Ácido Nucleico e Purificação de Proteína-Macherey, Nagel, DynaMagTM-2 Magnet, kit Detect-TB), enquanto a purificação de DNA com sílica, esferas magnéticas, esferas Chelex, entre outros, têm sido descrita para melhorar a qualidade do DNA. Além disso, muitos laboratórios usam métodos internos para esta etapa, principalmente para reduzir custos.

O método de extração de DNA que usa a ruptura celular por sonicação também tem sido usado em vários laboratórios, mas ainda há dúvidas sobre a eficácia do DNA extraído diretamente de amostras clínicas de escarro (que têm uma grande variedade de microrganismos, muitas impurezas, e dependência de boa coleta) para uso em PCR, pois o protocolo não inclui uma etapa de purificação. Portanto, este estudo teve como objetivo comparar uma técnica de sonicação como método de obtenção de DNA de amostras de escarro com o método comercial (resina de sílica – kit Detect-TB, comercializado pela Labtest / MG-Brasil). IS6110 – qPCR / SYBRGreen foi usado como método de confirmação para a detecção de DNA bacteriano.

Materiais, métodos e amostras

Foram coletadas 60 amostras de escarro de pacientes atendidos no Departamento de Tisiologia e Hanseníase de Canoas, RS. Inicialmente, para avaliar a extração de DNA com os dois protocolos da mesma concentração bacteriana, 20 amostras de escarro reconhecidamente de pacientes TB-negativos foram contaminadas com 25 μL (100 UFC / mL) de uma suspensão aquosa da cepa de Mycobacterium bovis .

A amplificação da qPCR foi verificada em 20 amostras de escarro de pacientes com tuberculose. Para determinar o limite de detecção, 20 amostras negativas foram contaminadas com 25 μL de diluições de 10 vezes de M. tuberculosis cepa de referência H37Rv.

As amostras de escarro utilizadas neste estudo também foram avaliadas em lâminas de esfregaço, cultura e GeneXpert MTB / RIF (Cepheid, EUA). O fluxograma da análise é apresentado na figura abaixo.

Preparação de amostra

As amostras de escarro foram descontaminadas e tratadas com hidróxido de sódio a 4% (NaOH) e solução PBS (solução salina tamponada com fosfato) contendo cloreto de sódio, cloreto de potássio, fosfato de sódio, fosfato de potássio monobásico e água ultrapura, a um pH ajustado de 7,4. Resumidamente, um total de 500 μL de escarro foi transferido para um microtubo de 1,5 mL e adicionado o volume correspondente de solução de NaOH 4%, seguido por homogeneização em vórtice e incubação a 37 °C por 15 min. Posteriormente, foi centrifugado 3000  g por 15 min e o sobrenadante descartado. O sedimento foi ressuspenso em 500 µL de tampão PBS e homogeneizado em um vórtice.

 

Extração de DNA

Protocolo A – resina de sílica (kit Detect-TB, Labtest / MG-Brasil)

O método da resina de sílica foi descrito por Michelon et al. (2011) 20 como uma adaptação do Boom et al. protocolo (1990). Resumidamente, o protocolo consistiu em uma etapa de lise celular com uma solução contendo cloridrato de guanidina 8 M, pH 6,4, EDTA 40 mM e 2 g / dL polioxietileno octil fenil éter, seguido de incubação em um termobloco a 100 ° C por 10 min, visando na liberação e solubilização do DNA genômico. A purificação do DNA liberado foi realizada por captação específica por uma resina de sílica na presença de agentes caotrópicos. Posteriormente, uma sequência de lavagem foi realizada com soluções distintas: a primeira contendo cloridrato de guanidina, a segunda contendo concentrado de cloreto de sódio tamponado a pH 7,0 e monolaurato de polioxietileno sorbitano 0,1%, e a terceira contendo cloreto de sódio concentrado e tamponado a pH 7,5 com polioxietileno 0,1% monolaurato.

Protocolo B – sonicação ( método interno)

Um microtubo contendo 500 µL de amostra de escarro pré-tratada como mencionado acima, foi colocado a 95 ° C por 20 min. Após essa etapa, foi colocado no banho de sonicação por 15 min e, em seguida, centrifugado por 5 min a 3.000  g . Posteriormente, 100 μL do sobrenadante (contendo o DNA) foram transferidos para um novo microtubo e congelados a −20 ° C até o uso.

Avaliação quantitativa do DNA extraído

A quantificação do DNA foi realizada por espectrofotometria. A absorbância e a concentração de DNA foram avaliadas quanto à pureza do ácido nucléico (razão ideal: A260 / A280 ≥ 1,8 e A260 / A230 = 2). As amostras foram quantificadas em espectrofotômetro SpectraMaxPlus® (Eppendorf) utilizando 2 μL de DNA de acordo com as instruções do fabricante.

Limite de detecção (LOD)

Colônias da cepa de M. tuberculosis H37Rv cultivadas em meio de cultura Ogawa Kudoh foram raspadas e colocadas em um tubo de vidro contendo grânulos para solubilizar e homogeneizar as colônias bacterianas e adicionada água ultrapura (o volume pode ser estipulado pelo operador). A turvação da solução bacteriana foi comparada com a turvação da escala Macfarland número 1 (amplamente utilizada em microbiologia, especialmente para antibiogramas convencionais). Diluições de dez vezes (solução escala de turbidez 1) foram realizadas. A partir dessas diluições, 25 μL foram misturados a 20 amostras de escarro TB-negativas. O mesmo volume de 25 μL das diluições foi inoculado em meio de cultura 7H10, e as UFCs foram avaliadas para cada diluição.

PCR em tempo real

Para avaliação da viabilidade do DNA extraído, a PCR em tempo real IS6110 foi realizada com o equipamento Step One Real-Time PCR Systems (AB Applied Biosystems) e os produtos amplificados foram detectados pelo SYBR® Green (fluoróforo). A reação foi padronizada em um volume final de 20 μL contendo 10 μL de Fast SYBR® Green Master Mix, 4 pmol de cada primer (INS1 5 ‘CGTGAGGGCATGGAGGTGGC 3 ′ e INS2 5’ GCGTAGGCGTCGGTGACAAA 3 ′) e 5 μL de DNA extraído e quantificado. As condições de amplificação foram as seguintes: ativação da enzima a 95 ° C por 20 s, desnaturação a 95 ° C por 1 segundo e, finalmente, anelamento e extensão a 62 ° C por 20 segundos.

Para cada corrida, um controle de reação negativo (mistura de PCR contendo água ultrapura) e uma referência de controle positivo ( M. tuberculosis H37Rv – 80 ng / μL) foram usados. As curvas de amplificação e dissociação foram analisadas com o software StepOne versão 2.3. Para a análise da curva de amplificação, os parâmetros “limiar” (nível de fluorescência detectável) e “linha de base” (limite definido dos ciclos de PCR) foram utilizados para determinar o Ct (limiar do ciclo) de cada amostra. A curva de dissociação foi utilizada para observar a possível amplificação de produtos não específicos ou dímeros de primer. Para padronização da concentração ideal dos primers a 4 pmol, utilizou-se a análise da curva de dissociação de amostras conhecidas e a análise dos amplicons em gel de agarose 1,5%, corado com brometo de etídio.

Curva padrão e eficiência

A configuração da curva padrão foi realizada de acordo com as recomendações do fabricante (AB Applied Biosystems-Thermofisher Scientific) – cinco pontos e em duplicata – para avaliação do protocolo de amplificação de DNA. Diluições de dez vezes foram realizadas a partir do DNA quantificado de M. tuberculosis cepa H37Rv (utilizando como marcador genômico o elemento de inserção IS 6110 da bactéria, por qPCR). A mistura de PCR continha 5 μL de DNA de cada diluição para cada reação e 15 μL da mistura, totalizando o volume final de 20 μL por reação. Eficiência, calculada usando o software StepOne versão 2.3, foi de 96,15% (valor de referência: 90-100%), R² de 0,97 (indica a proximidade do ajuste entre a linha de regressão linear da curva padrão e os dados dos pontos Ct individuais), -3,418 de inclinação (indica a eficiência de amplificação por ensaio de PCR) e inter Y de 16,87 (indica o Ct esperado para a amostra).

Aspectos éticos

O estudo foi aprovado pelo comitê de ética em pesquisa da Universidade Luterana do Brasil (ULBRA) (número de aprovação 2011-340H).

Análise estatística

Todos os dados foram analisados ​​por meio do IBM® SPSS® statistics (versão 21.0). O teste de Shapiro-Wilk foi utilizado para a análise do tipo de distribuição dos dados. O teste t de Student para amostras independentes e o teste de Mann-Whitney foram usados ​​para identificar possíveis diferenças nas concentrações de DNA e Cts obtidos entre os dois protocolos avaliados. Todos os testes realizados foram interpretados usando um nível de significância bilateral de 5% ( p  <0,05).

Resultados

A amplificação qPCR do DNA extraído das 20 amostras contaminadas com M. bovis (10 DNAs extraídos por protocolo) mostrou que o DNA extraído pelo Protocolo A (resina de sílica) foi detectado em 8 das 10 amostras (80,0%) e todos os 10 DNAs extraídos pelo protocolo B (sonicação) foram amplificados (100%).

A quantificação espectrofotométrica dos DNAs amplificados e a avaliação da pureza pelos diferentes protocolos são apresentadas na (Tabela 1). Em relação à pureza do DNA no comprimento de onda 260/280 nm, foram encontradas diferenças significativas entre os resultados dos dois protocolos (1,67 ± 0,35 vs. 0,97 ± 0,07; p  <0,01). No comprimento de onda de 260/230 nm, foi detectada diferença estatística entre os dados avaliados, o protocolo A diferiu do protocolo B (0,14 ± 0,12 vs. 0,74 ± 0,33; p  <0,01). Houve uma diferença significativa na concentração de DNA entre os dois protocolos usados ​​na análise (58,83 ng / µL ± 76,65 ng / µL vs. 340,43 ng / µL ± 154,34 ng / µL; p  <0,01).

As amplificações Cts por PCR em tempo real e as médias de cada protocolo de extração de DNA são apresentadas na (Tabela 2). Comparando os Cts do protocolo 1 vs. 2, houve diferença estatística (27,73 ± 2,48 vs. 26,92 ± 0,89; p  <0,01).

Em relação ao LOD (usando diluições de dez vezes do M. tuberculosis cepa H37Rv), com o protocolo B o ensaio qPCR detectou até 14 UFC (diluição 1: 1000), enquanto com o Protocolo A o LOD foi de inúmeras colônias.

Dentre as 20 amostras avaliadas de pacientes com TB, o DNA extraído com o Protocolo A foi detectado TB em sete das 10 (70,0%) amostras e em todas as 10 (100%) amostras de DNA extraídas com o Protocolo B (Tabela 3).

 

 

A pureza e a quantificação do DNA extraídas de amostras de escarro de M. tuberculosis seguiram os mesmos padrões das amostras contaminadas por M. bovis . A Tabela 4 mostra a pureza média e a quantificação do ácido nucleico extraído com os dois protocolos. Em relação à pureza do DNA no comprimento de onda de 260/280 nm, houve diferença significativa entre os dois protocolos (2,19 ± 1,62 vs. 1,09 ± 0,21; p  <0,01). Ao analisar a pureza do DNA no comprimento de onda 260/230 nm, não houve diferença significativa entre os dois protocolos (0,07 ± 0,04 vs. 0,68 ± 0,50; p  <0,01). Em relação à quantificação de DNA, houve diferença significativa (20,75 ng / µL ± 11,74 ng / µLvs. 37,01 ng / µL ± 36,91 ng / µL; p  <0,01) entre os protocolos utilizados na análise.

 

 

 

 

 

 

 

 

 

Os resultados dos Cts para as amostras de DNA extraídas de pacientes com TB usando os dois protocolos são mostrados na Tabela 5 . A diferença observada entre o Protocolo A vs. B não foi significativa (29,03 ± 4,14 vs. 26,48 ± 4,44; p  = 0,23) quando consideradas as amostras com DNA de Mycobacterium detectado.

 

 

 

 

 

 

 

 

 

 

 

 

Discussão

Avaliamos neste estudo se a extração de DNA de amostras de escarro (técnica simples e de baixo custo) com sonicação forneceria DNA adequado para a detecção do M. tuberculosis por qPCR, por meio da identificação da sequência de inserção IS6110, sendo relatada como a mais marcador genético específico e amplamente explorado (o número de cópias IS6110 por genoma pode influenciar a sensibilidade do teste). O escarro é a amostra biológica mais comumente utilizada para o diagnóstico da tuberculose pulmonar. Em comparação com a urina e o sangue, o escarro é mais espesso e viscoso, mas fornece uma visão melhor sobre a tuberculose e outras doenças respiratórias. Quando utilizadas diretamente para extração de DNA e posterior detecção por PCR, sabe-se que as amostras de escarro, apresentam barreiras relacionadas à presença de inibidores internos da Taq, bem como à presença de diversos microrganismos que fazem parte da microbiota do trato respiratório e oral. Assim, o preparo da amostra e a escolha de um método eficiente para extração de DNA é um dos principais desafios para o diagnóstico molecular da TB.

Quanto à utilização dos kits comerciais disponíveis , sabe-se que geralmente são preferidos por apresentarem maior reprodutibilidade, controle de qualidade e potencial de automação. Matrizes de sílica (kit Detect-TB, comercializado pela Labtest / MG-Brasil – Protocolo A) proporcionam ligação eficiente e seletiva de ácidos nucléicos (NA), tendo como característica o procedimento de purificação de DNA. O mecanismo envolvido nessa técnica é a afinidade entre o NA com carga negativa e o material de sílica com carga positiva, resultando na ligação seletiva do NA. Em aplicações clínicas, mesmo usando kits, obter altos rendimentos de NA ainda é um desafio, uma vez que as amostras de escarro frequentemente exibem uma baixa concentração final de DNA, que é mascarada contra um grande fundo de contaminantes.

Em nosso estudo, houve variabilidade em alguns padrões quanto à avaliação quantitativa do DNA extraído. No entanto, o Protocolo B proporcionou maior quantidade de DNA extraído, menores Cts na amplificação do plot (por qPCR) e perfis de fragmentos com aspecto mais uniforme, quando visualizados em eletroforese. Em consonância com nossos achados, o estudo de Krinitsina et al. (2015) mostraram que os valores de pureza e algumas concentrações de DNA medidas por absorbância diferem claramente dos dados visíveis de PCR em tempo real e detecção de eletroforese (intensidade de fluorescência de amplicons). Dependendo do método de extração aplicado, é importante ressaltar que a purificação de moléculas de DNA é conhecida por ser influenciada por suas especificidades de tamanho, composição de nucleotídeos, topologia e associação com proteínas. Acreditamos que resíduos de reagentes com diferentes produtos químicos, ou a necessidade de novas lavagens durante a aplicação dos protocolos, podem ter influenciado a leitura da absorbância. Portanto, uma avaliação quantitativa do DNA extraído não pode ser avaliada como um parâmetro absoluto.

De acordo com o estudo de Aldous et al. (2005), foi possível concluir que a etapa de purificação com resina de sílica não era necessária para a extração de DNA de amostras de escarro antes da técnica de PCR para identificação do M. tuberculosis, pois torna o método mais extenso e prejudica a rotina laboratorial. Comparando o uso do Kit (Detect-TB – Protocolo A) com o método interno (Sonicação – Protocolo B), concluiu-se que o DNA extraído pelo Kit apresentou maior pureza, mas a quantidade de DNA extraída foi, em muitos casos, inconsistente para detecção. Em um estudo de Psifidi et al. (2015), 3511 protocolos diferentes foram testados para extração de DNA e posteriormente usados ​​no sequenciamento genômico e de microarray. Dentre eles, o que obteve o menor tempo de execução, menor custo e melhores resultados foi o protocolo interno , como também demonstraram nossos resultados.

As análises de Liu et al. (2013), Greenly, e Tester (2015) mostraram que o uso de ultrassom permite que as paredes celulares sejam clivadas por ondas de choque, criadas por mudanças rápidas na pressão causadas pela sonicação. O estudo de Granger et al. (2004) relataram que o uso de sonicação melhorou o DNA micobacteriano, removendo bactérias de fundo e outras células. Além desses experimentos, estudos de Pchelintsev, Adams e Nelson (2016) mostraram que o uso de sonicação minimiza o risco de contaminação cruzada entre as amostras. Dai et al. (2016) concluíram que a técnica baseada em sonicação é considerada mais promissora, eficiente e econômica para a decomposição celular homogênea, em um curto período.

Em relação ao limite de detecção (LOD) do ensaio qPCR / SYBR Green, o Protocolo B forneceu uma boa capacidade de detecção (até 14 CFU / mL), mesmo para quantidades menores de DNA (diluição 1: 1000), consumiu menos reagentes, com menos etapas de execução, revelando-se método eficaz, menos trabalhoso, rápido e com maior potencial de aplicação em amostras de escarro. O LOD obtido em nosso estudo foi semelhante ao encontrado no estudo de Chakravorty et al. (2017), que analisou o desempenho do Xpert MTB / RIF Ultra como um ensaio point-of-care (POC) adequado para o diagnóstico de TB e obteve um LOD de 15,6 UFC / mL.

Reconhecemos as limitações potenciais do estudo. No entanto, nossos achados são importantes para orientar a escolha do método de extração de DNA aplicável a amostras clínicas de escarro. Estudos futuros podem consolidar nossos achados, permitindo assim uma maior compreensão da necessidade da purificação de NA para detecção molecular de microrganismos potenciais causadores de doenças infecciosas.

Conclusões e perspectivas

Técnicas de identificação baseadas em biologia molecular foram estabelecidas como ferramentas potenciais para o diagnóstico. Diante disso, este estudo mostrou que a extração de DNA por sonicação, mesmo sem apresentar etapas de purificação durante a execução da técnica, forneceu material genético adequado para identificação por PCR em tempo real, apresentando maiores concentrações de DNA, menores custos e complexidade de execução. Assim, é uma das técnicas de extração de DNA mais promissoras para uso em amostras clínicas de escarro de pacientes, apresentando alta aplicabilidade para o diagnóstico de TB, bem como o possível potencial para análises de epidemiologia molecular, como o Sequenciamento do Genoma Completo (WGS).

Financiamento

Graziele Bello e Jonas Michel Wolf foram apoiados pela CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior) / MEC / Brazil-Fellowship. Código de financiamento 001 .

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.